Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14507H8
Clone ID IST14507H8
Vector VICTR74
Project tigm

Sequence tag IST14507H8HMR1
Sequence
ATACCTTCCNNACCNGTCCCAGCCCCATTCCCATACATGGCCTTGGCTATGCATCCAAGAATCTAAAAACCATGGTTCTC
TGTCCCCGAGTGGACATGCCTCTGCTTGTCACCACCTTTCACACTCCCCTCTGCCAGGGCACCTGCCCCAGCCTTTCCCC
GGCTTGCCAGACCCTCTGTGTTCCATATAATGACCTGGATTCTAGTAATGATAATCCCTTGCTTAAAACTCTCTGGTGGC
N
Sequence Type genomic DNA
Unitrap ID UNI12980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128956366..128956606 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037938 (Chchd5) NM_025395 coiled-coil-helix-coiled-coil-helix domain containing 5 Gene [Source:MGI (curated);Acc:Chchd5-001]


Sequence tag IST14507H8HMF1
Sequence
TATTTAAACTAGAAAATGAAGGGAGTTGTGAAAGGAAAAAGCTACNATCAAGTTAGCCTCCTTTACCTCTCCNGTTGTGG
GTGAACTTGGTGGCTGCACCTGCTCTGCACACTGCAGGAAGCGGCGCATGTGTTCAGCACAGTTGCCCACTGCTGCCTCA
TTCAAGCGAAGACACTTNTNNNNNNNNTCAAAGGGCTCAGCACAGGCCTGGCGGATCTGGCGGATGATCNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037938


For any suggestions or comments, please send an email to unitrap@crg.es