Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W272D01
Clone ID W272D01
Vector ROSAbetageo
Project ggtc

Sequence tag W272D01
Sequence
GGGGGAGGAGGAAGCGACTGCCTCTGGATCTGCGGTGCGCGCCGGGCCGC
Sequence Type mRNA
Unitrap ID UNI8959

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32421008..32421057 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es