Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0672
Clone ID CF0672
Vector pGT0lxr
Project sanger

Sequence tag CF0672
Sequence
TTCAGAAACTATTGCCAGATGTTGGTATATCCTGCTTTCTGGATCAGNACTTGTATTGAGATTAAAATTTTCCTTCCTCG
CTTTCATTTTTGGTAAGCAGTTTGGAGGAAAAAGAGGATGTGATTGTCTTGTGTTAGAACCTTCAGAAATGATTGTGGTA
GAGAATTCCAAAGATAATGAAGACAGTATTTTACAAAGAGAAATTCCTGCCAGACAGTCTCGACGAAGGTTTCGGAAAAT
TAACTATAAAGGAGAACGCCAAACCATAATAGATGGAGTGGATATTAATAACTACCTTTCGCTTCCAGCTGATCTTACCA
AGATGCACCTCACAGACAACCCTCATCCACAGGTGACGCATGTGTCTTCTAGTCAGTCTGGCTGTAGCATTGCCAGTGAC
TCTGGGAGCAGCAGTTTATCCGATATCTATCAG
Sequence Type mRNA
Unitrap ID UNI1705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54374804..54424421 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037533 (Rapgef6) NM_175258 Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Rapgef6-003]

 
Come back to gene ENSMUSG00000037533


For any suggestions or comments, please send an email to unitrap@crg.es