Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M053F04
Clone ID M053F04
Vector U3betageo
Project ggtc

Sequence tag M053F04
Sequence
TTCGAAGACGACCTTCCTTGCTTTCAGAATTTCACCCGGGTTC
Sequence Type mRNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62247071..62247113 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es