Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12211E1
Clone ID IST12211E1
Vector VICTR76
Project tigm

Sequence tag IST12211E1HMR1
Sequence
ACAACTGGCAGCAGCAGCAGCAGCTGTATATTAGTCTCAGGTTCATAACANAGAAGGGTAGCCAGACCTTTANATACTGT
ACTGGCTAGTTTTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI30715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 73182626..73182723 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019718 (2810055F11Rik) NM_026038 RIKEN cDNA 2810055F11 gene Gene [Source:MGI Symbol;Acc:MGI:1914467]


Sequence tag IST12211E1BBF1
Sequence
TCATGACATATCANAGTCCCATTTCCTTCAGAATCAAAATTTCAGACTCAAGTTGCTGGCNNTAGGCTACTTCTGGTTGA
ATATTTTTATGAACTATAAAAAAGTTTTCTGCAAAAAATCTACCATTTCACAGGCCCAAGAGCAACACATAANCATTCTA
GTCCAATGTATCTGTAANTATTCGTTTCANNANTCCNNACNGTTTCTAACTNANGATGACTTTTTCNGANANANNANAAC
ATNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019718


For any suggestions or comments, please send an email to unitrap@crg.es