Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11468G9
Clone ID IST11468G9
Vector VICTR76
Project tigm

Sequence tag IST11468G9HMR1
Sequence
GAGGATACGTCGGGATCCGGAGTCTCACGTGCGACGGGGAGGGCGGCATTCGAGGGGTTCGGTAG
Sequence Type genomic DNA
Unitrap ID UNI2895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28371063..28371127 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]

 
Come back to gene ENSMUSG00000031490


For any suggestions or comments, please send an email to unitrap@crg.es