Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10807B4
Clone ID IST10807B4
Vector VICTR76
Project tigm

Sequence tag IST10807B4BBF1
Sequence
AGAACAAAGTGGGAGCCCGTGGGTGGACTGTGACCTGGGGTCTAAGGGAAAAAAGGACGGGAGGAGAGAGCTCTGGCAGA
TTCTCACAGGGACGAGAGTCCTTGTCTTGTGCAGCGGCTCTTGGGTTGGTGGAAGCCGTGGTGGAGAATGCAGGGAGGTC
TCCCGGGCGGGAGGTTAGATGCTGGCCCTTTAGTGGAAGACCTGCTCCATTGCTCCAGCACAGTGAGTCCCGATGGGAAG
AGGCAGTCCATGGTTTTAAGGCGTTTATTGTANAAAGGCAGAGAGAGGGAACGAGTAGGGAAGTAGAGGCTGGCCNTGGC
CNTGTGGAGAGAAGGGGGAAGGGGATAGGGAGAGAGGGGACAAGTGGGAAGCANGAGTAAGAGAAAGAGAGTCAGAGAGG
GAGGAGGGGGCAAGCANCCCCTTTTATAGTGGGCGGGGCCTACCTAGCTGTTGCCNNNTAACTGNGGAGCTGGAGTCCAC
ACAGAATACCAGGAACTTGGGGCATTGN
Sequence Type genomic DNA
Unitrap ID UNI13562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87435846..87436352 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es