Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14914H6
Clone ID IST14914H6
Vector VICTR76
Project tigm

Sequence tag IST14914H6HMF1
Sequence
GCTCCTCTGAAGACTAGAGCTCCAGAGTGAGAGAGCTACAGGGAAGCGGGGCTGGCTAGTCCCTTGGCTGGCCTGACTGA
CATACATCANACCCTGGCTGCCCTGGGTATANAAGCAACTCTGAACTTGTCCATGCTAGGCAGATGTGCCTAGCAGGGTT
CTAACAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCTGCCGGTGACACAAATGTCATCAGGGCCTCAAGAAGGTCAGTTCC
CGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTTTGAGGCCAGC
CTGGTCTACAAAGTGAGTTCCAGGACANCCNNGGCTACNCAGANAAANCCCTGTCNCNNANAANANGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634780..165635166 358
 
EST/CDNA Est Name
  DV066041.1 - AI427345.1 - CK622678.1 - AW762466.1 - BM963846.1 - W49202.1 - BG802683.1 - CA570430.1 - CA570198.1


Sequence tag IST14914H6HMR1
Sequence
GAGCGAGGTGCTCACTAANCTGTANACCTTCGCCTCANAGGAGATGGCAACTCTTCTCTTCATTCTCCTTGGCTTCTTGT
AACCCGAAGCTTGCTCAAGATCTGGAATTTCCAGGTGTTTCTCTGGGTGATCTGGATCTAAGAGGATACCAAGGAATGTG
GCCAG
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634620..165634783 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es