Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14113E9
Clone ID IST14113E9
Vector VICTR74
Project tigm

Sequence tag IST14113E9HMR1
Sequence
GTTCCNGGACAGCAAGAACTATATAGTAAGACCCTATCTGAAAAGGAAATACACACGAACATACGTTTCCCTGAACATTA
NAAGAGATTCTGCAGAANCCACTCTAAGAGCCTTGGAACTTACTCTTCCCTGACAATAGAGGCCTTGCCTTACTGTTTGC
CTCTGGTCTGGTTGTCATTCTCTGTCCTCACTCTAAATGCANAAACTACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI2754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110306518..110306730 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036057 (Ptpn23) NM_001081043 protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]


Sequence tag IST14113E9HMF2
Sequence
GAACTATGTAGACTAGGCTGCTCCTGAACTCACAGAGACCCACCTGCCTCTACTTCCCAAGTGCTGGGATTGAAGGTATA
TGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110306727..110306813 87
NO GENE  

 
Come back to gene ENSMUSG00000036057


For any suggestions or comments, please send an email to unitrap@crg.es