Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13056H12
Clone ID IST13056H12
Vector VICTR76
Project tigm

Sequence tag IST13056H12HMR1
Sequence
NATGAAAGGTTTTNNAGGCTATGGAAGTTGAGGGGCCGCTGTAGTGACCAGCAGGTTCTCCTTATTCAGCCTTCAGCAGT
TAGGAGCCTCTTTGCTCTACAGCCTCAGCCCCCACCCAGATCTTATGTTATCTTCGGGCCTTTTGGATGAGTTCAGGGAG
GGCCCAGCTCAGCAGATCCCCCCAATCCCTGTGCTCCTTGCATTGGCAGAGGTGTGAGCTGTGCCCGCACAAAGATGGGG
CATTGAAGAGGACTGACAATGGAGGTGAGGGGAACCCTGAACGCCTGCTGAGGTCAGCCAGGCCCCCCAGCAGGTGTGGG
GTGGAGGCTGGCTTTCCCTGCTCCTGTTGGTACANGAAGGTTGTAGACNCNNGGGACNGTCTACAGCTTGNTGTNNNNAN
GCGTGGGGNCTTGNGTTGCCGNCCNGCTNANNNCANTCN
Sequence Type genomic DNA
Unitrap ID UNI5556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97526592..97527018 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es