Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12359D7
Clone ID IST12359D7
Vector VICTR76
Project tigm

Sequence tag IST12359D7BBF1
Sequence
TACCAACTAAAAGAACATCAGAAAAACCCTTTGTAGCTGATTGTTGAAAGCCAGCCTGCGGCTCACAATAAATGGGTACA
CCTGGGAGGCAAGCCAGGGCTGAAAAGAGAGGGGAAAACTAGGCGGTCGAGAGAAAAATGGAGCCAAGACAGGGTTCCTG
ATCGAGGCTCAAATGTTTAATGGCAAATATGCTTATAAAGGAGGGGGGAGGCCCATTCCCTCCAAATTCATCCTTGGAGC
CTGGAACCAGCTGCAGGTGGTTCCAGGATAGGGTGTAGTCTCCAGAATAGCTCAGGGGCCTCTCAGCAGGAGGAACAGTG
GCAGTGGCTGAACAATANAGTGAGCTAGGGAGGAAAGCTCCACCCTAGGTAATCTCCTTAGTGGCAGCAAGGTCAAGGTC
TGGCTNAGCCTGCTTCANGCTGGGGGGANGTTACAGATTGCTACAGCTAGATTCTGTGTTCTTTCTGCTCTTCATTTTCN
ANTGNTACCTGTAGTGTANGCNANGTGGCTGANNCTCTCATATCCATCTNAAAANTGANGATACN
Sequence Type genomic DNA
Unitrap ID UNI30636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62916951..62917494 514
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056199 (AC130827.3)  


Sequence tag IST12359D7HMF1
Sequence
TACCAACTAAAAGAACATCAGAAAAACCCTTTGTAGCTGATTGTTGAAAGCCAGCCTGCGGCTCACAATAAATGGGTACA
CCTGGGAGGCAAGCCAGGGCTGAAAAGAGAGGGGAAAACTAGGCGGTCGAGAGAAAAATGGAGCCAAGACAGGGTTCCTG
ATCGAGGCTCAAATGTTTAATGGCAAATATGCTTATAAAGGAGGGGGGAGGCCCATTCCCTCCAAATTCATCCTTGGAGC
CTGGAACCAGCTGCAGGTGGTTCCAGGATAGGGTGTANTCTCCANAATNNCTCAGGGGCCTCTCAGCAGGAGGAACAGTG
GCAGTGGCTGAACAATAGAGTGAGCTAGGGAGGAAAGCTCCACCCTAGGTAATCTCCTTANTGGCAGCAAGGTCAAGGTC
TGGCTCAGCCTGCTTCANGCTGGGGGGAGGTTNCAGATTGCTACNGCTAGATTCTGTGTTCTTTCTGCTCTTCATTTTCT
ATTGTTANNNGTNNNGNANGCNANNTGGCTGANNCTCTCNTATNNNTCTNNAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000056199


For any suggestions or comments, please send an email to unitrap@crg.es