Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12285B10
Clone ID IST12285B10
Vector VICTR76
Project tigm

Sequence tag IST12285B10HMF1
Sequence
CCATGACCGTNTGNGCCTTNAACCCTACNACACACTTTTGTTATTGACCTGGCAAATAAGGNNTTTCTTGNCTCCTGTAT
GACTGACCTACNTCCTTAACCCNCANAACACTTATTCTAACACCATTGTACAGATAAGGAAACCACAGCTCACACAGCTA
AGGTAGCTTACCCAAAATCACACAGCCAGAAAATGGCGGAGCCCAAATGAAACCAGTTTCCCTCACACACCTCTCTCCTA
TTTGCAAGGCCTAAGGAATGGCAGTTGGTATTCCACACATTTACACAGAAGCCTTTCTTATCTCCAAGTCTGTCTCTCCT
GANCCCACCAGCTTGCATTCCTCACACCTTGCCTTGGGGGACACCAGAACTACCCCTTCCTAAGTCTGTGTGAGCTCCTT
GGTGCCCAGACACCTTCTCTGGCTCCCCAGTGCCCTCCCTTGGATCTNAATCTGANANGTCCTCCTTCTGAAGCCCACTC
TGCACCCTCTTGCTCTGANCTCCNGGNNCCATGGGGAGCTTCATGCTN
Sequence Type genomic DNA
Unitrap ID UNI31466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3582501..3583027 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065952 (C330021F23Rik) NP_001019899 RIKEN cDNA C330021F23 gene Gene [Source:MGI Symbol;Acc:MGI:3612471]


Sequence tag IST12285B10BBF1
Sequence
CCATGACCGTCTGTGCCTTTAACCCTACAACACACTTTTGTTATTGACCTGGCAAATAAGGTCTTTCTTGTCTCCTGTAT
GACTGACCTACATCCTTAACCCCCAAAACACTTATTCTAACACCATTGTACAGATAAGGAAACCACAGCTCACACAGCTA
AGGTAGCTTACCCAAAATCACACAGCCAGAAAATGGCGGAGCCCAAATGAAACCAGTTTCCCTCACACACCTCTCTCCTA
TTTGCAAGGCCTAAGGAATGGCAGTTGGTATTCCACACATTTACACAGAAGCCTTTCTTATCTCCNAGTCTGTCTCTCCT
GAGCCCACCAGCTTGCATTCCTCACACCTTGCCTTGGGGGACACCAGAACTACCCCTTCCTAAGTCTGTGTGAGCTCCTT
GGTGCCCAGACACCTTCTCTGGCTCCCCAGTGCCCTCCCTTGGATCTTAATCTGAGANGTCCTCCTTCTGAANCCCACTC
TGCACCCTCTTGCTCTGACCTCCN
Sequence Type genomic DNA
Unitrap ID UNI31466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3582501..3583003 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065952 (C330021F23Rik) NP_001019899 RIKEN cDNA C330021F23 gene Gene [Source:MGI Symbol;Acc:MGI:3612471]

 
Come back to gene ENSMUSG00000065952


For any suggestions or comments, please send an email to unitrap@crg.es