Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10072B10
Clone ID IST10072B10
Vector VICTR75
Project tigm

Sequence tag IST10072B10HMR1
Sequence
CCNTGNGGTTNCNGGGATTTGAACTCCGGACCTTGGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCNTCTCACCAGC
CCCCCATATTTGAATTCTTAATACAAATTCCCCAAGAACAGCTCCACTTCCAGTTCAGCCCTGTTACCCAGTTCCTGCCT
CATTCATAGTAAGCATTCAACAAATATTATTTTTGAGTTAATAAGTGTCGGGGTGAAAGTTANTAAGACGAAAGGGAGGT
GAGCTAAATGAGACCATCANATTCTTGAAAGACTGACTTGCGTTCTTGGTAAAACTGCCTGATGGAAAATTCAGAAGGTT
GTTTTGAGATAGAGTGAGTTTATCTGGCCTTTGGTCCTANGCAGAGATCTTCACCGATAACCTTTAAGGAAAATCACCCT
ANAGCATCTAGACACAAAGGGATCCCTTATCTACTGATCNANNNCCTGACCTTAAGAGTGAGTTCCNAGATGGNCNGC
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53959455..53959927 445
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


Sequence tag IST10072B10BBF1
Sequence
TTGGTGGCTCACAACCATCTGTAACAAGTGACTCCCTCTTCTGGAATGTCTGAAGACAGCTACAGTGTACTTACATATAA
TAAATAAATCTTTAAAAAAAAANAATTCAAATATGGGGCTGGGTGCGGTGGTGCACAACTTTAATCCCAGCACTTCAAAG
GGACAGGTANACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53959281..53959457 171
NO GENE  


Sequence tag IST10072B10HMF2
Sequence
ANNGGGCTGGAAATCCCAGTGCCCACCAGTAAATGGGCAGGGAGGGTGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29753787..29753835 49
NO GENE  

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es