Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F032F01
Clone ID F032F01
Vector pT1ATGbetageo
Project ggtc

Sequence tag F032F01
Sequence
GTGCACTGGCGGAGTTCAGCTGGCCTTCGCGTCAC
Sequence Type mRNA
Unitrap ID UNI10834

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71202789..71202823 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es