Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A006F10
Clone ID A006F10
Vector pT1ATGbetageo
Project ggtc

Sequence tag A006F10
Sequence
CCCTGCACTCTGTCGATGAGTCGGAGAAGTCCC
Sequence Type mRNA
Unitrap ID UNI10483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75257670..75257702 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042688 (Mapk6) NP_081694 mitogen-activated protein kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1354946]

 
Come back to gene ENSMUSG00000042688


For any suggestions or comments, please send an email to unitrap@crg.es