Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14189E3
Clone ID IST14189E3
Vector VICTR74
Project tigm

Sequence tag IST14189E3BBF1
Sequence
GTTTATTTTTAATGCGCATTGGTGTTTTGCCTGCATGCATGTCTGTGTGAGGGTGTCAGATCCTCTGAAAATGGAGTTAC
AGATGGTTGTGAGCTGCCATGTGAGTGCTGGGAACTGAACTCGGGACCTTTGGAAGAGCTGCTGGTGCTCTTAACAGCTG
AGGTGTCTCTCCAGCCCCTTTGGGTGTGTTTTGTTTTGTTTGNTNNGNTTTGCNTNNTCAANACNNGGTTNCTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14189E3HMR1
Sequence
AAACAAATCCTTCAAAACAAAGCAAAAACACCCAGAGATTCCCAGCATATATGGTAGAGCTGAGACCCTAATCTGACCCT
AATCTGACCAATGCATAGGTGGGGAGGACCGCCACCTGTGATCACCCTCATCCTTACCTTCCCCTTCCTCCCCTTGGTCA
GAGGGCTCAGTTTCTCCCANACTCTCAGAAGTGAACTAAACCCCAGTCTGCAAGTAANACAGACTCANCACTGAGCATGG
TGCCACCGTTCCTGGAACTTGGANCCTCTGTTTCCCCATCTATAAATTGGGAATCANCAAAGGCCTACCGGCAGGGTTGG
AAGTCACTGGCTATTANAGAACAGGATGCTTGCCCTCTGATATCCTTTGACCTCTGCCTGGCCNTGGGCAACTTTCCNGC
CTTTGCTTCCCTTGGCTCCNNGCCTGGCCNNCTN
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250076..100250504 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


Sequence tag IST14189E3HMF1
Sequence
GTTTATTTTTAATGCGCATTGGTGTTTTGCCTGCATGCATGTCTGTGTGAGGGTGTCAGATCCTCTGAAAATGGAGTTAC
AGATGGTTGTGAGCTGCCATGTGAGTGCTGGGAACTGAACTCGGGACCTTTGGAAGAGCTGCTGGTGCTCTTAACAGCTG
AGGTGTCTCTCCAGCCCCTTTGGGTGTGTTTTGTTTNGTTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250501..100250700 198
 
EST/CDNA Est Name
  BI557474.1

 
Come back to gene BI557474.1


For any suggestions or comments, please send an email to unitrap@crg.es