Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P016D07
Clone ID P016D07
Vector FlipROSAbetageo
Project ggtc

Sequence tag P016D07
Sequence
AACCCCCGCCGTAGCTGCCGCTGCTCCCGCCGATCACCGCCTCCGAG
Sequence Type mRNA
Unitrap ID UNI1557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52174609..52174654 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es