Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14833D3
Clone ID IST14833D3
Vector VICTR76
Project tigm

Sequence tag IST14833D3HMR1
Sequence
GTAGTTTTTTGTTTTTGAAACAGAGTTTATCTGTGTATCCATGGCTGTCCTGGAATACTCTCTGGAGACCAGGTTGGCCT
CAAATTCACTGANATCTGCCTGCCTCTACCTCTCAAGTGCTGAGATTGAAGGCATGTGCCAACACAACCCGTATTGAATT
GTTC
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043411..92043573 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST14833D3HMF1
Sequence
CTACCAGCTGGTATTTGGCAATTATCAACTAATGAACCATACATTACCGATATATACTAATAAGACAACATAAACCTATT
TTGCATTTTACAAACCCAAACAATTCTAATTTCTATATTAATAAGTTAAAAAACTTGTAAAAGCAGTAATATAAAATATC
TCTTTTCTTCTGTTAGGTCCCTACCACTACAGAGAGATCTAATTCATTAAAGTCTTAGTTTTATTAGTGGCAAGCCTGAC
ATCTCTACTTCACCCTCTACCAAAAATACAGCAATTTCTGAGGTAAAAGGTCTTTTGTTTTTGCTTTGGGCTTGGGTTGG
TTGGCTTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043085..92043414 330
 
EST/CDNA Est Name
  BF467383.1

 
Come back to gene BF467383.1


For any suggestions or comments, please send an email to unitrap@crg.es