Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10541G11
Clone ID IST10541G11
Vector VICTR76
Project tigm

Sequence tag IST10541G11BBF1
Sequence
AGATAGCATTTTCATGTATGAGTTTTTGCCTGCATGTGTGTATATATGTATACAACCACATGCCTGATACCCACATAGGT
CAAGAAGGTATTTAATTTCCTGGAACTGAAGTTACCATTGGTTGTGAGCCACCATGTGGTGTTGGGAATCAAACACCANT
CTCCTATAANAGCAATAAGTGCTCTAATCTATTGAACCATCTNTTGAACCTTTAAAAATCATAATATTATTATTACTGTG
TGGCTTGCATGTATGACTGTGGGTACATGTGTANATGTGAGAGGGAAACTGTCTGGGAACTGCAAGGTTTCCCTGTTGTG
CCNTCTACGTGGTCCTGGTTTGAATGCTATGTGACATGAATATTTTGCGTATTATGAGTTCATGAAAATAATCTCTTGGG
CTTTTTGTGTGGTTGTTGNNNTANTTGTTTATTGNTAAAACAAACTTATTTTGTAGCCCTANGCTAGCCNTGAACCTGTC
ATTTTNCTGCCTCANCCTNCN
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154304546..154305043 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]


Sequence tag IST10541G11HMF1
Sequence
AGATAGCATTTTCATGTATGAGTTTTTGCCTGCATGTGTGTATATATGTATACAACCACATGCCTGATACCCACATAGGT
CAAGAAGGTATTTAATTTCCTGGAACTGAAGTTACCATTGGTTGTGAGCCACCNTGTGGTGTTGGGAATCAAACACCANT
CTCCTATAANAGCAATAAGTGCTCTAATCTATTGAACCATCTNTTGANCCTTTAAAAATCATAATATTATTATTACTGTG
TGGCTTGCATGTATGACTGNGGGTACATGTGTANATGTGAGAGGGAAACTGTCTGGGAACTGCAAGGTTTCCCTGTTGTG
CCNTCTACGTGGTCCTGGTTTGAATGCTATGTGACATGAATATTNNGCGTATTATGAGTTCATGAAAATAATCTCTTGGG
CTTTTTGTGTGGTTGTTGNANTANTTGTTTATTGNTAAAACAAACTTATTTTGTAGCCCTANGCTANCCTTGAACCTGTC
ATTTTNCNGNNTCAGCCTNNNTNAATACAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es