Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12688G3
Clone ID IST12688G3
Vector VICTR76
Project tigm

Sequence tag IST12688G3BBF1
Sequence
GTGGTTTTAGGTCTCAGGAAAGGCAACTTTTTATTCTTCCTTGAGCAGGTGAGGTTGATTAATATTGTAATTGGTGATGG
TTCTTATTGTCATGGAGAAAAAAAAAAAAANGCTTTAAATTTAATTTGGACTTAN
Sequence Type genomic DNA
Unitrap ID UNI32275

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121630513..121630646 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es