Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14886A12
Clone ID IST14886A12
Vector VICTR76
Project tigm

Sequence tag IST14886A12HMR1
Sequence
CTCTGTAGANNNACCTCAAAGATCTGCCTGCCTCTGTCTCCTAGGTGCTTCAATGAAAGACATGTGCCAACATGCAGAAC
ATGCTGCCTTGGTTGCTTTGTTGTTGTTGCTGTTGGTTTGGTTTGGTTTGGTTTTGAGGGN
Sequence Type genomic DNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23734958..23735098 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es