Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14771B8
Clone ID IST14771B8
Vector VICTR76
Project tigm

Sequence tag IST14771B8BBF1
Sequence
CCATGTCTCAAATTTTCTAAGCTTTCTAACTGATATAGCAAAANAAAACTCANGAAGCCGGCAAGGTTAGGGGCTCATGT
GGGCTGGTGTTTCAGGTTAGGGGCTGGAGGGGGGTCCTTCAATGCNNGGGAAGGTCAGGANGCCNTTGTGGCTTGCANCC
TCTACTTCANGCACTANANANACCTANGTGACTCTCTGCCCTTCAGTTTCTTCTGGACTGAAGGTTTGTGCCTGCAGCTA
ACACTTCCCCTCAGCCCCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14771B8HMR1
Sequence
GTATCTTTCTAACATCTCAGGGGAACTCAGGGGAACTGGAGTGTACTGCTT
Sequence Type genomic DNA
Unitrap ID UNI11610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73572506..73572556 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST14771B8HMF2
Sequence
ATACCTGACAGTCACATCTAGCCTCTGTATATACGTGCAAAAATTCCTGTGTACGTGCATACACACACACACACACACAC
ACACACNCNNNANACANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73572553..73572638 86
NO GENE  

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es