Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14103A9
Clone ID IST14103A9
Vector VICTR74
Project tigm

Sequence tag IST14103A9BBF1
Sequence
TGGTGAGATGGCTCAGTGGGTTAGAGCACCCGACTGCTCTTCCGAAGGTGCAGAGTTCAGGTCCCAGCAACCACATGGTG
GCTCACAACCATCCGTAACAAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI2503 UNI9274 UNI31285 UNI31286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55943437..55943543 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52753341..52753447 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55808961..55809067 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98833826..98833932 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36961806..36961912 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86449398..86449504 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038024 (Dennd4c) NP_001074483 DENN/MADD domain containing 4C Gene [Source:MGI (curated);Acc:Dennd4c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33698192..33698298 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079562 (Maea) NM_021500 macrophage erythroblast attacher Gene [Source:MGI Symbol;Acc:MGI:1891748]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148307804..148307910 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78416235..78416341 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049624 (Slc17a5) NM_172773 solute carrier family 17 (anion/sugar transporter), member 5 Gene [Source:MGI (curated);Acc:Slc17a5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55003081..55003187 103
NO GENE  

 
Come back to gene ENSMUSG00000049624


For any suggestions or comments, please send an email to unitrap@crg.es