Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15027F7
Clone ID IST15027F7
Vector VICTR78
Project tigm

Sequence tag IST15027F7HMR1
Sequence
ATCCNGGCCNNANACTGTCTTCAGTTGTCTCCAGATACTAAACCCACAAGTCTTTCCTGAAGCCCACTGCTGGATTCAGT
ACTCTTGACTGAAATTTGACCTTAGGTTTTTCTGCTTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI10643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77802800..77802921 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]


Sequence tag IST15027F7HMF1
Sequence
TTGTGTGGGTGTTTACAGCCAATAGTTCTCTGTCATACATGTGACAGGGGACCCTTGGCTTTGCTGGGATATCCCTTANC
TTTCTCACTGTTGTGATAAAATAGCTGACATAAAGGACTTACNGTTTCAGGGGTTCTTGCACNGTCTGNNNGCCCCNANG
CNNTCNNNTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es