Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M077C02
Clone ID M077C02
Vector U3CEO
Project ggtc

Sequence tag M077C02
Sequence
GNNNATCACATCTCCCTGGCTCCCTGCTCACCGCCAGTCACCCCCCAGAGGCAGTCTCTGGAGGGGGCAAGTAACCCGAG
AGGTGATGACAACTTTGTCGCCTGTATGGCCAACAACAGCCAGAGTGTCCTTTCAGTTAGCTCCTTGGGGCAGTGGTCAG
ATCCTGTCAGTACTTCGGGGCTTGAAGACTTTTGCACAGAGACCATCTCAAGCTCCGGAGACAAAGCTATCACCCCACCA
CTGCCAGTCAGTACTCAGCCCTTCAGCAACGGGGTGCTGAAGGAGGAGCTGTCAGACTTAGGGACCGAGGATGGATGGAC
CAGGATACAGAAGCAGATCATCAGGA
Sequence Type mRNA
Unitrap ID UNI9298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88705574..88705917 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es