Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M076C07
Clone ID M076C07
Vector U3CEO
Project ggtc

Sequence tag M076C07
Sequence
CCCTGTACCCCAACAACTTCCAGTTCCGGTACCATGTCAGTTCGGCCGCGCAGGCGGGCT
Sequence Type mRNA
Unitrap ID UNI2797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59387643..59387702 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025232 (Hexa) NM_010421 hexosaminidase A Gene [Source:MGI Symbol;Acc:MGI:96073]

 
Come back to gene ENSMUSG00000025232


For any suggestions or comments, please send an email to unitrap@crg.es