Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14036F6
Clone ID IST14036F6
Vector VICTR74
Project tigm

Sequence tag IST14036F6BBF1
Sequence
CTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTC
CCCTGCCGGGTGGGCACCTGTCCTCCGGTCCGGANTT
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI31227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 27826467..27826580 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 47902824..47902937 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 82116088..82116201 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 70947050..70947163 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22619824..22619937 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84628987..84629100 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14462471..14462584 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54200880..54200993 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020332 (4930404A10Rik) NP_083381 RIKEN cDNA 4930404A10 gene Gene [Source:MGI Symbol;Acc:MGI:1922097]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82369465..82369578 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521388..35521501 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57052692..57052805 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59583148..59583261 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7437306..7437419 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21861256..21861369 114
 
EST/CDNA Est Name
  BX512183.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 56650621..56650734 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 22834377..22834490 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66036159..66036272 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 40279820..40279933 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46152270..46152383 114
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324715..7324828 114
NO GENE  

 
Come back to gene BX512183.1


For any suggestions or comments, please send an email to unitrap@crg.es