Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10111C4
Clone ID IST10111C4
Vector VICTR76
Project tigm

Sequence tag IST10111C4BBR1
Sequence
TACACAAACCGGTTGTGATGACCTCGCACCCAGTACTTGGTTAAGAGGAGACAGACGGCTGTTTCTTTCGTATCAAAGCT
AACAAAACGGAAAATAAGCATGAAATAACTGGTAGGTAGTGAAATGGAGTAAAATCTTTTAACACGTAAAATGTAACTAA
ATCTTAAGAGGTTCTCTGTCTGTCTGATTTACCCCAAGTATGTGACTTGCAGCTCTTGGACTCTCTGAAGCTATTAAAAG
TTACAGCGTATATCTGCGGTAAGAGAAAAGGTCTACCTCATTTTCTGACTTCTGTTTGCTGCTGTGATTTGATAAAAAAA
AAAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75496162..75496490 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es