Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10896H8
Clone ID IST10896H8
Vector VICTR76
Project tigm

Sequence tag IST10896H8HMF1
Sequence
GTATGGAAATCTCTCCNAAGCATGCCTGACCTTGGTGCCTATGCCCTANCCTGAAGGGAACTCAGTGGCTTGTAGCAGGA
ATTCATGATGAGGCCCTGGCTCTGTGTCCTTTCCACATGCTCTGGA

Sequence Type genomic DNA
Unitrap ID UNI21324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72958031..72958155 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005947 (Itgae) NM_008399 integrin alpha E, epithelial-associated Gene [Source:MGI (curated);Acc:Itgae-001]


Sequence tag IST10896H8HMR1
Sequence
TTCNTACAGGGTAGGGAGTTACTCNACTCACCCTTGAGGCCTCTCCTGGCTAAGTTCTAAGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72957973..72958033 59
NO GENE  

 
Come back to gene ENSMUSG00000005947


For any suggestions or comments, please send an email to unitrap@crg.es