Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P014E08
Clone ID P014E08
Vector FlipROSAbetageo
Project ggtc

Sequence tag P014E08
Sequence
GGGGGAGATTGGCAGGGAGGGCGGAATGTAAGATGGCGCCCAGGGAGCTGTGAGGAGAAAATCCTGTCGGTCTCGGAGCG
GCGACGGCAGAACCGAGGCCCCGGGCGGTGAAGCGGGGCCGGCGGGTAGAACGGAGGCAGCGTCGGCGGTGAAGTCGCCG
G
Sequence Type mRNA
Unitrap ID UNI1575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108419418..108419571 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es