Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10713F3
Clone ID IST10713F3
Vector VICTR76
Project tigm

Sequence tag IST10713F3HMF1
Sequence
CTAGGGGCAAAGCAGAGAGCTCTAGGTCAAGGATATGGTGTGGAGGACCAGTGAACCCCAGGTANAGAGAGGGGAGAGGT
GGGTAAGAGTGACAAGAAACCATTTCCTGGGTACCCAGGGCAAGACATTCAGGGACAGCTTGCTGCTGTTCGTGAGCCTG
ACGCTGTTATCACTTACCGTTTGCAGTTAATAGGTGAGCCTTGAACATTGATCTGACCAATATTTGCTTANATCACTGAC
CTAGGGGACTTCCATGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI32595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144002689..144002949 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074758 (EG433481) predicted gene, EG433481 Gene [Source:MGI Symbol;Acc:MGI:3645019]


Sequence tag IST10713F3BBF1
Sequence
CTAGGGGCAAAGCAGAGAGCTCTAGGTCAAGGATATGGTGTGGAGGACCAGTGAACCCCAGGTANANAGAGGGGAGAGGT
GGGTAAGAGTGACAAGAAACCATTTCCTGGGTACCCAGGGCAAGACATTCAGGGACAGCTTGCTGCTGTTCGTGAGCCTG
ACGCTGTTATCACTTACCGTTTGCAGTTAATAGGTGAGCCTTGAACATTGATCTGACCAATATTTGCTTANNTCACTGAC
CTAGGGGACTTCCATGTCAACCCTTACCTAGTGGCAACCTGAGAACTGGTCCTGTGATCCNNGANGGGTCATGTCCGGAA
AAGACCATTTCCCCACAGGTCCCACCTGTGGGTGTAGGCTGGGGGCTGGGGCCTGGGGCAACCACCTGCANANATTCTGT
TCCAAGTGATTCCTTTGTGCANGTGGTCANAAGTCATCAAGATTGGTCACAGCTGCCTCCACAGGTCCNNGCTGTCTGGG
TCCTATTTCCGCCCCANCCATNNNGACNACACNNGCCTAANGANANANAGGNNTTGTTTCTNANANAANACAGNNNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074758


For any suggestions or comments, please send an email to unitrap@crg.es