Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G069F11
Clone ID G069F11
Vector U3CEO
Project ggtc

Sequence tag G069F11
Sequence
CACCCCTGTCCCGTGGCCTGGAGTACAATGAGGTCAACGTCACACTGGACCTGGGCCAGGTGTTCCATGTGGCCTATGTG
CTCATCAAGTTTGACAACTCACCTCGTACGTGACCTCAAGGGNNGATGTGACAGGTACCNNCAGAATTCNNGTNNNNCAC
ATTAGNNGGTCCGTGAGNNNNGTCTNNCGACCGGTGCCGCGTCTCCGAGGGAGGANNNTACGGAGGNNNGGNAGAANNNG
Sequence Type mRNA
Unitrap ID UNI9493

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179943020..179955989 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015647 (Lama5) NM_001081171 laminin, alpha 5 Gene [Source:MGI (curated);Acc:Lama5-001]

 
Come back to gene ENSMUSG00000015647


For any suggestions or comments, please send an email to unitrap@crg.es