Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12511C8
Clone ID IST12511C8
Vector VICTR76
Project tigm

Sequence tag IST12511C8BBF1
Sequence
AGCCTGGTCTACAGAATGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAA
Sequence Type genomic DNA
Unitrap ID UNI32322 UNI32597 UNI32598 UNI32599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6395978..6396047 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 25321717..25321786 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024269 (5730494M16Rik) NM_001004361 RIKEN cDNA 5730494M16 gene Gene [Source:MGI Symbol;Acc:MGI:1913898]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25913490..25913559 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18711563..18711632 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96104287..96104356 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74005128..74005197 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021098 (Six6os1) NM_029444 Six6 opposite strand transcript 1 Gene [Source:MGI Symbol;Acc:MGI:1923051]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51929741..51929810 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 40661825..40661894 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79288133..79288202 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035852 (9130017N09Rik) NM_030218 RIKEN cDNA 9130017N09 gene Gene [Source:MGI Symbol;Acc:MGI:1926156]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 38635217..38635286 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 75441138..75441207 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103915214..103915283 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052539 (Magi3) NM_133853 membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI (curated);Acc:Magi3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147413633..147413702 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 21762034..21762103 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 90924470..90924539 70
NO GENE  


Sequence tag IST12511C8HMF1
Sequence
AGCCTGGTCTACAGAATGAGTTCCAGGACAGCCAGGGCTACACAGANAAACCCTGTCTCCAAAACAAACAAACAAACAAA
CAAACACCCACAGTGTTTATTTTAACGGCTTTATAATATTTGTTTGTTTACATATATTTCTTAAACTAGTTTCTTCCTTA
AGTTCTTTCTTCCCTTCCTATTTTTTTTTTNAANNTTTNNNGN
Sequence Type genomic DNA
Unitrap ID UNI17406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87439402..87439599 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es