Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0724
Clone ID CG0724
Vector pGT0lxrT2
Project sanger

Sequence tag CG0724
Sequence
CTCATGGCCATCGATTCAGAGCTGGTGGATCGGGACGTGGTTCACACGTCAGAGGAGGCTCGAAGGAACACACTGATAAA
AGACACCATGCGGGAGCAGTGCATTCCAAATCTGGTGGAATCGTGGTACCAGATTTTACACAACTACCAGTATACGAATT
CAGAAGTGCTGTGCCAGTGCCTTGAAGTAGTTGGGGCCTACGTCTCCTGGATAGACTTATCCCTTATAGCCAATGATAGG
TTTATAAATATGCTGCTAGGTCACATGTCCGTAGAGGTTCTACGGGAAGAAGCATGTGACTGCTTGTTCGAGATTGTAAA
TAAAGGGATGGACCCTGTGGATAAGATGAAACTCGTAGAGTCCCTGTGTCAAGTATTACAGACTGCTGGGTTTTTCAGCA
TTGACCAG
Sequence Type mRNA
Unitrap ID UNI1716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121050279..121052114 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es