Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14987F5
Clone ID IST14987F5
Vector VICTR76
Project tigm

Sequence tag IST14987F5HMR1
Sequence
CCNTTGCTAGCCCCAGTGTTCACATAATCTGTAACTCCCGACTAGGTGGAGAAATGGAACCGACGTGATCAGAAGCTGCT
GGAGGCGGTGCAGCGGGGGGACGTGGGACGCGTGGCTGCCTTGGCCTCTAGGAAGTCAGCCCGACCCACCAAACTAGACT
CAAAT
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96482011..96482175 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST14987F5BBF1
Sequence
ATGGTATGGGGAAAGAAAAGTGATATTAGATGCCCAGCAAGAATAAAGGAGCCAGGCAGTGACTGACAGAAACCCTGTCT
CAAAAAACCAAGAGTAAAGGAGCATTCTAGAGGTCCTTGCTGCTTATTATCACTTGTTCTTAAGGGGGCCAGCAAAACAC
TAACCACTCCATGTGTCATCAAGAATTATCCATAGCAACCGTCAAACATAGACCTAAAGGTGCTTANGGGATCTCTGAAT
TAAAAATTACNAAGGTTGGTGTGGTGGCTCAAACTTTCCACATAATACTANTACGCCNGGAGGTNANNGCNGGANGATCT
TGCCCAGCCTCANCTACATANCCNNCTTATANGCNGTTNNNNANTCNTGAAGCGCNNCNTGCNNGTGTGTACNCATGTAN
ATGCNGANNTNTACNCNCANANNTNTGTANTGGCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14987F5HMF1
Sequence
ATGGTATGGGGAAAGAAAAGTGATATTAGATGCCCAGCAAGAATAAAGGAGCCAGGCAGTGACTGACAGAAACCCTGTCT
CAAAAAACCAAGAGTAAAGGAGCATTCTAGAGGTCCTTGCTGCTTATTATCACTTGTTCTTAAGGGGGCCAGCAAAACAC
TAACCACTCCATGTGTCATCAAGAATTATCCATAGCAACCGTCAAACATAGACCTAAAGGTGCTTAGGGGATCTCTGAAT
TAAAAATTACGAANGTTGNTGTGGTGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481749..96482014 262
NO GENE  

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es