Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14623D4
Clone ID IST14623D4
Vector VICTR74
Project tigm

Sequence tag IST14623D4HMR1
Sequence
ATACCNGCACTCAGGACACTGAGGCAGGAGATTGCTACAGTTAAGAGCCNGTTTATATGGCAAGACCTTGTTTCCTAGTA
TTTGAAAACAAAATTATGTTAATGCCAAGAAAAGCACTTAGAAGAGCACTCAGTATCTAACAAACATGCTGCTCTTGTCT
TATCAATATGTCTTATATTGCCNGGGCTGGGCCANACATATTGACTTGTCNATATN
Sequence Type genomic DNA
Unitrap ID UNI12218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4538707..4538921 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]


Sequence tag IST14623D4HMF1
Sequence
GTATACACTACTATATGCAACATCACACACCACTCTTTCCTCGCATTCATTCATATATATATACATATATATATATATGA
ATCAATTAANTAATTAANTTTGTTACATCGTANACNGGGTCTCATGTANCCTAANCTGTTTTTGAACCAATCTTTCTGAC
TCAACCTCCTGAGTGCTGANATTACAAGTATGTGTCATCACATCTGACTCTANATGCTTCANTCCCAACTATGTACNCNN
GCNCTANACTTTGANTTTTAAAAGGACCNNGACCGGTGTGCACCACTCTACAGTCTATGCTGGGCAAAGCANCANAGGCC
AATCAATANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020412


For any suggestions or comments, please send an email to unitrap@crg.es