Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q021F04
Clone ID Q021F04
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q021F04
Sequence
TGGCCCGTGGGCGGCGCTTCACGGAGGCGTAGGGAAGCAATGGCCGCTGACG
Sequence Type mRNA
Unitrap ID UNI11900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125029159..125029210 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029387 (Gtf2h3) NM_181410 general transcription factor IIH, polypeptide 3 Gene [Source:MGI (curated);Acc:Gtf2h3-001]

 
Come back to gene ENSMUSG00000029387


For any suggestions or comments, please send an email to unitrap@crg.es