Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793A12
Clone ID IST14793A12
Vector VICTR76
Project tigm

Sequence tag IST14793A12HMR1
Sequence
GGTACCACTAGACCNAGGCTGTGACCTCCCANANGGCATCAGTAGAGGACTACACATTCAGCTTCAAGCCTTGCTAGAAT
TTCTGCTTCTTAAGATGTCTGCCTGACACCTAGATGGTGTTGGGAGTGAAGCTGTCACCAGGACGTANAGGACTTACTGA
AAAGATGGCTTGGGAGTGAGGACCTGGGTCCACAATCCCAAGTAACCTTAATCTCCAAAATTGGTCTCGGNAAAAAGCAN
AGGTTCCAAGAAAGATAGGCTTATTAACNAAAGAGAGGCAGGGCCCNGNATGANTGGCN
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117047013..117047310 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14793A12HMF1
Sequence
GTACCCAGTGCCCTGGGAGCTTCTGGCGCATCTTAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117047306..117047346 41
NO GENE  


Sequence tag IST14793A12BBF1
Sequence
GTACCCAGTGCCCTGGGAGCTTCTGGCGCATCTTAGTTAACTGTCGGGCTGATGGGAAACATCTGGTAAACTGAAAACTG
ATATGATAAAGCTGCCTTAAGGATGATCTGGACAGCCTATGTTGCCCCATCTGTTATTGGTTGCTGCCAACATGCATATG
AGAAACGGCTAAGAAGCCTGTGAGATGGCTCAGTGGGTTGGAGGCATTTTCTAACAATTCTCATGACCTGAGTTTGATCT
CTGGACCCTACGTANTGAAANANANAACAAACTNNCACNAGTTGCNNTCTGATCTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117047306..117047601 278
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es