Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12860H11
Clone ID IST12860H11
Vector VICTR76
Project tigm

Sequence tag IST12860H11HMR1
Sequence
CTACAATAAACCCAACATTANTTCCCAAGAGAGCTGAAGAATTAGCCCCGGCTGAGATCCATCATGAAGTACACAGAAAG
TCCCAACCAGAGCAGGGGCTGCCCCAGGGCCCAAGTTCAGAAACCACCGGGAAAGCCACAGGACAGCAACCAAACACCAA
TGGGGGGCAGAACCTTGGCCTCCAGAACACTGAGCAGGTGTGTGCTGNCN
Sequence Type genomic DNA
Unitrap ID UNI31125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96487497..96487703 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST12860H11BBF1
Sequence
GTAGCCNGTGCCTTCTGCTGCTTCTTCAGCTCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 45428766..45428804 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96487462..96487500 37
NO GENE  

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es