Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10262D3
Clone ID IST10262D3
Vector VICTR76
Project tigm

Sequence tag IST10262D3BBF1
Sequence
GTGTACATGACAGGCGAAATTCATTTGCCTTGCAGCCCAACTCCATTTCCCAAATAGCAAGATACAGAAAAGCCCAAAGA
CTAAAAATTATTTATTTCTCCTAGTCAGTCATGCAGCTCCTGACAAATTGACTTCTTTACACTCGTGAGCATGAACGCGT
ACATTTATGTGCTNATATAAAGAGCATGGCCTCTTAAAAGANCAGTAACGGGCTNNANAAATGGCTCAGTGGTNNAGANC
ACCN
Sequence Type genomic DNA
Unitrap ID UNI32608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738143..30738385 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST10262D3HMF1
Sequence
GTGTACATGACAGGCGAAATTCATTTGCCTTGCAGCCCAACTCCATTTCCCAAATAGCAAGATACAGAAAAGCCCAAAGA
CTAAAAATTATTTATTTCTCCTAGTCAGTCATGCAGCTCCTGACAAATTGACTTCTTTACACTCGTGAGCATGAACGCGT
ACATTTATGTGCTCATATAAAGAGCATGGCCTCTTAAAAGAGCAGTAACGGGCTGGAGAAATGGCTCAGTGGTTAAGAGC
ACCGGCTGCTCTTCCAGANGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTNATAACCNTCTCTAATAGGATCTGA
TGCCCTCTTCTGGTGTGTCTGAAGATGGCTACAGTGTACTCACATAAAATAAACAAATCTAAAAAAAAGAAAAAAAAAGA
GCAGTAACATCATATATACNGTTCTGTAACTTACGGCTCTTATTTAACCATTGATGTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI32608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30737922..30738385 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es