Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14330B2
Clone ID IST14330B2
Vector VICTR74
Project tigm

Sequence tag IST14330B2HMR1
Sequence
ATGGAAAATGGCATTTGAGGCTGGAGTGATGGCTCAGTGGTTAAGAACACTGGGTGCTCTTCCGGAGGACC
Sequence Type genomic DNA
Unitrap ID UNI30560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125633222..125633292 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]


Sequence tag IST14330B2BBF1
Sequence
TCATAACAATAGAAGCCTTATGAGTTACATGCTATATAAATATTATCAATTGTAAGATACTCATTTAAAAATAATTACAT
GCTGGGCAATGATGGCACATGCCTTTAATCCCAGCACTTGGGGGGCAGAGGCAAGCAGATTTCTGAGTTTGAAGCCAGCC
TGGTCTATAGAGTAAGTTCCAGGACAGCCAGGGCTATACAGAGAAACTGTCTTGAAAAAACAAAAAAAGAAAAAAAAATT
ACNTGTTAAAATGAATAATTTTACNNANNAATANTAATGTTTAAAAAAAAAAAAAANNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 145731903..145732198 284
NO GENE  

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es