Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14374G4
Clone ID IST14374G4
Vector VICTR74
Project tigm

Sequence tag IST14374G4BBF1
Sequence
AAATGACTTTGAGCTTTTGATCCTCCTGCCTCAGCACCTTAATTCTCAGTCACTAGTTTTGTTGCTGTTGTTCACCTGGC
TGCTTTGTTGATGTTTGTTTTTGTGTGGCAGGGTGTGACTGAATAGCACCGACCTTCCTGGAACCACGCTTTGTGTANTC
TAGGCTGGAATTGACTAAAATCCCCCTGCCTCTGCCTGCAGAGTGCTGAGATTAAAAAGTGTGTGCCACCACACCTAGCC
CATTAACCTGCAGTTTTGAAGCTGTNNACAGTTCCTGGTTGGCTTTANTGTGAACTTGTGACCTTTTNACAGANGACNAT
TGANNCNNAGGNCN
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120712979..120713301 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]


Sequence tag IST14374G4HMF2
Sequence
NCACAATGACGGTGTGGGTCCTGGATCTACGCCCANGGATGCCNNCCNGTTCNAGTTTCCGCANANAGGGCNNCNCCTCN
NGACCCCNCCCNACCTTGAAGGGCCNCTCGACCTTGAGGACCATGTTTGCCTCANTTACTTGCNCTGTGCANTGGGAANA
TACNCNGTNCCNCTGGGGAANACNNNGNGCCCCNNCGCNTTCCTNAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es