Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14431E12
Clone ID IST14431E12
Vector VICTR74
Project tigm

Sequence tag IST14431E12HMR1
Sequence
CCTCTCTTTGAGGGGGTGATCCCTACCCGGGAATCTGCTTCCCGGNNNACTGAGGCCCCCTGCAAATTGACAGTTTC
Sequence Type genomic DNA
Unitrap ID UNI23338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121766010..121766085 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038412 (Higd1a) NM_019814 HIG1 domain family, member 1A Gene [Source:MGI Symbol;Acc:MGI:1930666]


Sequence tag IST14431E12HMF1
Sequence
NTTTCCACCCCAGGAATAAACGAGGGAAGCAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14431E12BBF1
Sequence
CTTTCCNCCCCAGGAATAAACGAGGGAAGCAGAGAACAGAATCGAGTCANCCGGACGGCTGGCACACCTGANCCTTANTC
GTGCTTTTGTGATCTCTGCACCCCGTTCCCTTGTCAGGGGCATTCGCATTCCGCCACAGCCTTCCCTCCTCCATCCGGTG
ACACAGGGTCACGTAAGGTCTGCNCNNNNNCNGGGTGGCGCCCGGGAAGGCCAGGCCGANGTGCCCNANCGCNGCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038412


For any suggestions or comments, please send an email to unitrap@crg.es