Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14882H12
Clone ID IST14882H12
Vector VICTR76
Project tigm

Sequence tag IST14882H12HMR1
Sequence
ATTGGAGTTCATTAGGATTTGTCTGCTGTATTTCTTANGATTTGGCCGGATTTAAGATATAAGCAGTCTGTCAGTGGGGC
TTCTCCCTGGTAAGACTAACCCTGACCGTGGAGAGGCTGCTAGGCTTCCCTCATACAGGCCTTTAACTGCCTGTGTCTGT
CTGCTCTCTTGAANGAAGTTTCTATGTGCTATCCATGTCNNGN
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336002..148336200 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es