Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14681C3
Clone ID IST14681C3
Vector VICTR74
Project tigm

Sequence tag IST14681C3HMR1
Sequence
ATGTGAGGTTTAAATGGAGCTGTACACGGGGTCACTTGTAAATTAGCCTTTCTATTTGTCATACACATTTACTAGCCAGA
TTTTACCAAGGACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650430..66650526 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST14681C3BBF1
Sequence
CCCTTCAAATCCACACTCAGCGCTAGGATCGTGGCTCAGTAGGCAGCGTCCTCGCCTCGCATGCACAAAGCCCCGAGTTC
AGTCCTCAAGGCTCCCAGCTCTTCTAACGCAAAGGCAGGAAGGACAGAAGTTCAAGGTCACTCTTGACAACCGAGCCAGC
CCACCTCAAAACAAAACCCCAACCATTAAAGCTATTTGCCTAGGTCTTTGTCTGCCCACTGACAGAAGTCTGGCCTGGGC
AGCTTCTCTTCTGGGGTTTCACGCTGGGACAGGATCAAGCAGCAATTCAGAAGTCCAGCCCCCGCCCTTTTCACTCCCCT
GCCCCAAATCTGTCTAATCAACAGCTTTTTATTCTGCCTTTTCCCACTGTGAGCCCGCTCCCCAACTGCAAACCACGGGC
CATTGTCNGCTCCTGTCCCCATGGGATCTCTTTCCCTGCCTCGCTCTGGTCTTGTGACCGTGTTCTGCAGGGTCTCCNCT
TCACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30017164..30017648 481
 
EST/CDNA Est Name
  CF745309.1 - CJ123803.1 - CJ126368.1 - CJ126434.1 - CJ127660.1 - BF461065.1 - BF465688.1


Sequence tag IST14681C3HMF2
Sequence
CCCTTNAAATCCACACTCANCGCTAGGANCGTGGCTNANTANGCANCGTCCTCGCCTCGCANGCACAAAGCCCCGANTTC
ANTCCTCAAGGCTCCCAGCTCTTCTAACGCANAGGCAGGAAGGACAGAANTTCAAGGTCACTCTTGACAACCGANCCAGC
CCACCTCAAAACAAAACCCCAACCATTAAAGCTATTTGCCTANGTCTTTGTCTGCCCACTGACAGAAGTCTGGCCTGGGC
NNNTTCTCTTCTGGGGTTTCACNCTGGGACAGGATCAAGCAGCAATTCAGAANTCCAGCCCCCGCCCTTTTCACTCCCCT
GCCCCAAATCTGTCTAATCNACAGCTTTTTATTCTGCCTTTTCCCACTGTGANCCCNCTCCCCAACTGCAAACCACGGGC
CATTGTCNGCTCCTGTCCCCATGGGATCTCTTTCCCNGCNTCNCTCTGGTCTNGNNACCNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CF745309.1 - CJ123803.1 - CJ126368.1 - CJ126434.1 - CJ127660.1 - BF461065.1 - BF465688.1


For any suggestions or comments, please send an email to unitrap@crg.es