Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14868A4
Clone ID IST14868A4
Vector VICTR76
Project tigm

Sequence tag IST14868A4HMF2
Sequence
CTTTAAAGCAGCCGGGCGTAATCCCAGCACTTGGGAGGCAGAGACAGGAGGATTTCTGAGTTCCAGGCCAGCCTGGTCTA
CAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65260099..65260240 142
NO GENE  


Sequence tag IST14868A4HMR1
Sequence
GGTTCTGCTAATTCNGAACACAAGGCAGCCCCACATACAACTCAGCAACCGAGGCCNCCTGCCTACTCTCCCCAGGCGCA
GTTCCAGCTGTTCCTCCTGCCCCGCTTGCTGTTCGCTGCTTGGATGCACTGACGCTTCCTGTCCTGTTTGCTTCCCTGCT
TTTCTCTTTGAGTGCTCACCCANAATCCTCCCTGCCTTTATCTGGCGATCACTTCACTCCTCGAGCATAGCTCCCTGGCT
CCNTGNATACNCTGTGTATATTAAAAACACTCTCGGTTTACTGAGCCTAGATCTCTAGTGCTAACTCCGAACTACACACA
GTTTTCATTTAANCTGTGAGGGAATGGCNNGANGTANGTGTTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104163913..104164277 343
NO GENE  


Sequence tag IST14868A4BBF1
Sequence
AACCTCCTTTAAATGAAATCTGGAAAAGTGTGGGGTAGAAAGCGTGGTTCAGAGCGATAAGGAATCTTTAAAGAAAGAGA
AAGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAACAAAGAAAGAAAGAAAGA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGA
N
Sequence Type genomic DNA
Unitrap ID UNI32177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104164274..104164513 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es