Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11069H9
Clone ID IST11069H9
Vector VICTR76
Project tigm

Sequence tag IST11069H9BBF1
Sequence
AAAACTACCTTGTTAAAAAAAAATTTAAGGAAATTATTTTTGTGTGTTAGTGTGTCTAATTGTATAAATTATCAACACAC
CATTGTAAGTAGTATAGGTATAAGATACAGTATATGGTAGACATTATAATAGAGTTCTATAAATAAATGGAAGGAACTTA
ANAACATTGTAAAGGTAAGGTAAGATAAAATGAAAGACTACGTAACTGTTTAATAAGTGTAGTTTATAGCCTGAACTTCA
NCTCCTCTTCCTAACTTACTCCATGAAATTTGATAATATTGCCNTTCTCAAACTATGTAACCTGTTATTANTTGTAGAAA
TAGGAGGCAGGTGAATTTTCTGGTCGTGTTTTACAAAAGGAAAGTTGTANTTAGCGTGTATCAAACAGCTCCGATTTCTA
ACAAGTGANCATCTGGTGCTCAGAANCCTTACCCAAAGCGNTGGTTCTCTTTGANCACCTCTTNCTGNGANANNAAGTTA
ATAAAACTGNNNNACTTCATCTTACTCCCTTCACNGGGCAAATTTATATCTCTTCTTTGNANNANAN

Sequence Type genomic DNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130312298..130312836 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]


Sequence tag IST11069H9HMF1
Sequence
AAAACTACCTTGTTAAAAAAAAATTTAAGGAAATTATTTTTGTGTGTTAGTGTGTCTAATTGTATAAATTATCAACACAC
CATTGTAAGTAGTATAGGTATAAGATACAGTATATGGTAGACATTATAATAGAGTTCTATAAATAAATGGAAGGAACTTA
ANAACATTGTAAAGGTAAGGTAAGATAAAATGAAAGACTACGTAACTGTTTAATAAGTGTAGTTTATAGCCTGAACTTCA
NCTCCTCTTCCTAACTTACTCCATGAAATTTGATAATATTGCCATTCTCAAACTATGTAACCTGTTATTAGTTGTAGAAA
TAGGAGGCAGGTGAATTTTCTGGTCGTGTTTTACAAAAGGAAAGTTGTAGTTAGCGTGTATCAAACAGCTCCGATTTCTA
ACAAGTGAACATCTGGTGCTCAGAAACCTTACCCAAAGCGTTGGTTCTCTTTGAACACCTCTTCCTGTGATAGGAAGTTA
ATAAAACTGTANNACTTNATCTTACTCCCTTCACANGGCAAATTTATATCTCTTCTTTGAANTNNAN
Sequence Type genomic DNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130312296..130312836 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es