Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14564C12
Clone ID IST14564C12
Vector VICTR74
Project tigm

Sequence tag IST14564C12HMR1
Sequence
NGACCCGCTATCTCCAGACAAGAAGCTACCTGGGAATGGTGTGGACTTTTGAAACCTCAAAGCCTACTCCCAGTGACAAA
CCTCCTCCAATAAGGCCACATCTCCTTCTCAAACANTCCTACCAGTGGAT
Sequence Type genomic DNA
Unitrap ID UNI16102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95600804..95600932 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042043 (Tbca) NM_009321 tubulin cofactor a Gene [Source:MGI Symbol;Acc:MGI:107549]


Sequence tag IST14564C12BBF1
Sequence
NNNNNGANNAANGCTCNCANCTACTACNNNANNANCNNNNATGCNGNNNNATTCTATGATGATGGACATGGACTCTAACA
TTCTGAAACTCTTGAGTCCCAATAAACTTCTGTAAATTGCCTTGGTCACAGCGTCTACAAAGCAATGGAAAAGCAACACA
CACACAGGTCTTATGCTTAGCTTCTGCAAGTTTTGGACTTGCATGCTGTGCATCTTATATTTCATTATTATCACAGAGTC
GCTGTTTTAGTTATCATCATGTAACAACTATTATTCATTTGTATTCAGAATCCAGTGCCTTATCAACAAGGCAGAGTGTT
TCCAAATATTTCTGGTTGCTAAACTTCTCTAAAAAAGTAGTCANTCNTCAGTAGTCCNTCCTCNNNNNNNNNNGACATTT
ATGAAAGANAAACANTTTNNNGGAGTCCACATTCNCTGTTTCCNGCCTGTGGTNAGTNANAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14564C12HMF1
Sequence
GTCAGGACTAAGGCTCTCAGCTACTACTCTATCACCTCATATGCTGTCACATTCTATGATGATGGACATGGACTCTAACA
TTCTGAAACTCTTGAGTCCCAATAAACTTCTGTAAATTGCCTTGGTCACAGCGTCTACAAAGCAATGGAAAAGCAACACA
CACACAGGTCTTATGCTTANCTTCTGCAAGTTTTGGACTTGCATGCTGTGCATCNTANATTTCATTANTNNNNCANANTC
GCTGTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042043


For any suggestions or comments, please send an email to unitrap@crg.es