Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10512G8
Clone ID IST10512G8
Vector VICTR76
Project tigm

Sequence tag IST10512G8HMF2
Sequence
TAATAATGCCATTCAGGCTGCCTTCTCTCTGCCNAGTGCCATGTCAAACCCACCATGTGTGGTGTCATTAATTCTGCTCT
GCAGCCACCCGAGGGACAGTCTTGGGTTGCTCTCTGCTTACATTTGGAGTTGATGGGGCTTCTCCAGGGTCACAGAGTCA
CCTGTAGCAGTGCCTCCCCAGCCCAGGAGGACCAGAGGGAGCCAACGTTGTANAATGTGGCTGAGTTCAAGAGGGTATAG
GATCTTCCTAACTGCTTTCNATNATGACTTTTTTGTTTGTTTTTAGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI32613

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84327279..84327587 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020037 (Rfx4) NM_027689 regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]


Sequence tag IST10512G8BBF1
Sequence
TAATAATGCCATTCAGGCTGCCTTCTCTCTGCCAAGTGCCATGTCAAACCCACCATGTGTGGTGTCATTAATTCTGCTCT
GCAGCCACCCGAGGGACAGTCTTGGGTTGCTCTCTGCTTACATTTGGAGTTGATGGGGCTTCTCCAGGGTCACAGAGTCA
CCTGTAGCAGTGCCTCCCCAGCCCAGGAGGACCAGAGGGAGCCAACGTTGTAGAATGTGGCTGAGTTCAAGAGGGTATAG
GATCTTCCTAACTGCTTTCGATTATGACTTTTTTGTTTGTTTTTAGTGTGTGTGTGTGTGTGTGTGTGTNNANCNNANAG
GGCNNNCTNNNTTTTCANNTTTNNNNTTTTNNGGACAGGGTCTNNTGTNANTCANTGNCNACNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020037


For any suggestions or comments, please send an email to unitrap@crg.es