Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14727F7
Clone ID IST14727F7
Vector VICTR76
Project tigm

Sequence tag IST14727F7HMR1
Sequence
CCTTGACTCGGTAAGCCTTCACATAAATGCGCACATACACATGTCTTTGGTCTCTGCACTTGGCAGACTGGACCAGGAGG
ATTCGCTGCAAGTTTGAGGCAAGCCTGGGCTACAGAGAAAGTTCCTGAGTAGCCTTAGCTACACCATGATGTCTCAAAAA
AAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI32614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57001801..57001966 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]


Sequence tag IST14727F7HMF1
Sequence
AGGTCAGTCTCCTCTGTACCTCCTCAGCCACCCTCCATGCTGGGTTANAACACTGGGCCTCCACTGGCCTGCTGCTTGCA
GTGAGGCAGGAGGGCTGGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57001964..57002065 100
NO GENE  

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es